Question Details

(solution) Hello, There are some questions and I need help with. Can anyone


Hello,


There are some questions and I need help with. Can anyone help me answering them?

Thanks.


1. You are studying a new enzyme isolated from an organism capable of growing at boiling water

 

temperatures. You obtain data of a wild-type enzyme and a mutant form recently found in a culture of

 

this same thermophilic organism growing on the bench (a graduate student forgot to put the culture in

 

the 90°C incubator). You have determined that the two enzymes differ by one amino acid in the

 

sequence of the respective enzymes within the active site. You name the wild-type enzyme Hot Stuf

 

and the mutant Not-so Hot Stuf. Below is a table of their activities. Maximum

 

Velocity

 

Hot Stuf 58 µmole/min Not-so Hot

 

Stuf 0.2 µmole/min Km

 

0.0058

 

M

 

0.0002

 

M a. Which enzyme has a higher affinity for the substrate?

 

b. What is the initial velocity of the reaction catalyzed by Hot Stuf at a substrate concentration of

 

10 mM?

 

c. Which enzyme shifts Keq, the equilibrium constant, more in the direction of the product?

 

d. What amino acid change would likely eliminate the Not-so Hot Stuf enzyme from allowing the

 

bacteria to grow at high temperature? The key amino acid in the wild type enzyme is a

 

phenylalanine residue.

 

2. Why does the glycolytic pathway occupy a central position in cell metabolism?

 

3. What is accomplished in the preparatory phase of glycolysis? 4. What is accomplished in the payoff phase of glycolysis?

 

5. What is the efficiency of recovery, in the form of ATP, of the energy released by glycolysis under

 

Standard conditions?

 

6. Is efficiency of energy recovery higher under the conditions that exist in living cells? Justify your

 

answer. 7. In the reaction below, what is being oxidized? What is being reduced? 1 8. The C-1 of glucose is radioactively labeled and then enters glycolysis, which carbon of glyceraldehyde3-phosphate will be labeled? What fraction of molecules will carry the radioactive label?

 

9. The figure below represents a cross section through a membrane and the seven circles represent a ?top

 

down? view of the seven a helices of bacteriodopsin. What classes of amino acid side chains would

 

you expect to be projecting from the regions that interact with the membrane lipids, and what side

 

chains would you expect to find projecting into the pore? This type of orientation is termed what? 10. What are histones? What is their function(s)? Describe the structure shown below. How does it

 

demonstrate the special characteristics of histones? The figure is taken from the PDB 5CDK. a. What is the sequence of the mRNA that encodes this protein? 2 b. What is the amino acid sequence of this particular protein?

 

c. What is the pI of this protein and how does this relate to its function?

 

You may find it helpful to utilize the NCBI website. 11. Which restriction enzyme(s) would you use to cleave the plasmid in order to insert the following cut

 

pieces of DNA?

 

GATCCTGCAGAAGCTTCCGGATCCCCGG

 

GACGTCTTCGAAGGCCTAGGGGCCCTAG

 

AATTCTGCAGAAGCTTCCGGATCCCCGG

 

GACGTCTTCGAAGGCCTAGGGGCCTCGA What will be the phenotype of the bacteria that are transformed, separately, with the

 

recombinant plasmids? 3

 


Solution details:
STATUS
Answered
QUALITY
Approved
ANSWER RATING

This question was answered on: Jan 30, 2021

PRICE: $15

Solution~0001016691.zip (25.37 KB)

Buy this answer for only: $15

This attachment is locked

We have a ready expert answer for this paper which you can use for in-depth understanding, research editing or paraphrasing. You can buy it or order for a fresh, original and plagiarism-free solution (Deadline assured. Flexible pricing. TurnItIn Report provided)

Pay using PayPal (No PayPal account Required) or your credit card . All your purchases are securely protected by .
SiteLock

About this Question

STATUS

Answered

QUALITY

Approved

DATE ANSWERED

Jan 30, 2021

EXPERT

Tutor

ANSWER RATING

GET INSTANT HELP/h4>

We have top-notch tutors who can do your essay/homework for you at a reasonable cost and then you can simply use that essay as a template to build your own arguments.

You can also use these solutions:

  • As a reference for in-depth understanding of the subject.
  • As a source of ideas / reasoning for your own research (if properly referenced)
  • For editing and paraphrasing (check your institution's definition of plagiarism and recommended paraphrase).
This we believe is a better way of understanding a problem and makes use of the efficiency of time of the student.

NEW ASSIGNMENT HELP?

Order New Solution. Quick Turnaround

Click on the button below in order to Order for a New, Original and High-Quality Essay Solutions. New orders are original solutions and precise to your writing instruction requirements. Place a New Order using the button below.

WE GUARANTEE, THAT YOUR PAPER WILL BE WRITTEN FROM SCRATCH AND WITHIN A DEADLINE.

Order Now